search for




 

First Korean case of factor V Leiden mutation in pregnant woman with a history of recurrent pregnancy loss
Journal of Genetic Medicine 2019;16:23-26
Published online June 30, 2019;  https://doi.org/10.5734/JGM.2019.16.1.23
© 2019 Korean Society of Medical Genetics and Genomics.

Sung Hee Han, Jung Jae Seo, Eun Seol Kim, Jae Song Ryu, Seong Hyeon Hong, and Seung Yong Hwang

1Division of Biotechnology, Bio-Core Co. Ltd., Yongin, Korea, 2Department of Obstetrics and Gynecology, Women’s I Hospital, Pohang, Korea
*Sung Hee Han, M.D., Ph.D. https://orcid.org/0000-0002-7058-9952, Division of Biotechnology, Bio-Core Co. Ltd., IT valley, 13 Heungdeok 1-ro, Giheung-gu, Yongin 16954, Korea. Tel: +82-2-330-2013, Fax: +82-2-853-4607, E-mail: hansungh@bio-core.com
Received March 13, 2019; Revised May 10, 2019; Accepted May 11, 2019.
cc This is an open-access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.
Abstract

Thrombophilia refers to inherited or acquired hemostatic disorders that result in a predisposition to blood clot formation. When combined with the hypercoagulable state that is characteristic of pregnancy, there is an increased risk of severe and recurrent pregnancy complications. Activated protein C resistance caused by factor V Leiden (FVL) mutation is known to be the most common cause of inherited thrombophilia in Caucasian population. FVL mutation has been related to pregnancy complications associated with hypercoagulation, e.g. miscarriage, intrauterine fetal demise, placental abruption, and intrauterine growth retardation. Although the FVL mutation is easily detected using molecular DNA techniques, patients who are heterozygous for this disorder often remain asymptomatic until they develop a concurrent prothrombotic condition. Because there are potentially serious effects of FVL mutation for pregnancy, and because effective treatment strategies exist, early detection and treatment of this condition might be considered.

Keywords : Factor V Leiden, Mutation, Recurrent pregnancy loss, Thrombophilia, Hereditary
Introduction

Recurrent pregnancy loss (RPL) has been public health concern, developed 1 in 300 pregnancies and 2–4% of reproductive-aged couples. RPL is defined as 2 or more spontaneous abortions before the 20th week of gestation [1]. An estimated 50% of RPL is idiopathic. Most couples with RPL should be evaluated for genetic and non-genetic causes. Thrombophilia has been suggested as one putative etiology of RPL [2]. Inherited thrombophilia is a genetic disorder of blood coagulation resulting in an unusual hypercoagulable state, which in turn can result in abnormal implantation and may manifest as spontaneous fetal loss [3]. The inherited predisposition to thrombophilia is most often associated with factor V Leiden (FVL) mutation (c.1601G>A), coagulation factor II (F2, also known as prothrombin) gene variant (c.20210G>A), and methylenetetrahydrofolate reductase (MTFHR) gene variants (c.677C>T and c.1298A>C) [4].

Activated protein C (APC) resistance is known to be the most frequent genetic cause of venous thrombosis, accounting for up to 40% of all thromboses. The FVL mutation, inherited as an autosomal dominant trait, is responsible for 95% of cases of APC resistance [5]. The FVL mutation is caused by a point mutation in the F5 (OMIM 612309, NM_000130.4), encoding a substitution of arginine for glutamine at position 534 of the factor V molecule located on chromosome 1q24, the site at which APC cleaves factor Va. The FVL mutation renders factor Va resistant to the anticoagulant effects of APC, resulting in a genetic predisposition to thrombosis [5]. The distribution of FVL mutation varies greatly in ethnic groups. The FVL mutation is reported in 5% of the healthy white population, 1% of the healthy black population, reaching 10–15% in some European countries [6]. However, it appears that FVL mutation is extremely rare in Africans and Asian countries [7], and until now, there has been no report of FVL mutation positive detected in Korean population [811]. Here, we present the first Korean case of FVL mutation in pregnant woman with a history of RPL.

Case

The patient was a 36-year-old Korean woman, gravida 7, para 1, aborta 6, who presented with RPL at her initial obstetrical visit. Her past obstetrical history was significant for 1 ectopic pregnancy and 5 early first trimester miscarriages, followed by 1 full-term delivery by caesarean section. She had no previous history of preeclampsia, placental abruption, or intrauterine growth retardation (IUGR). The results of her physical examination were within normal limits. For evaluation of RPL, she was tested for complete blood count, coagulation profile, thyroid function test (T3/free T4/thyroid stimulating hormone [TSH]), prolactin, natural killer cell proportion, anticardiolipin antibodies immunoglobulin (Ig) M/IgG, lupus anticoagulant screening, anti-β2 glycoprotein-1 antibodies IgM/IgG, thyroid peroxidase antibody, protein C and S functional activity, antithrombin III activity, homocysteine, TSH receptor antibody, thyroglobulin antibody, chromosomal analysis, and genotype for FVL mutation (c.1601G>A), F2 gene variant (c.20210G>A), and MTFHR gene variants (c.677C>T and c.1298A>C).

Her baseline complete blood count, coagulation profile and thyroid function test were within normal limits. Serum prolactin was 10.6 ng/mL (normal range, 2.8 to 29.2 ng/mL). Serum homocysteine was 8.65 μmol/L (normal range, 6.72 to 15.16 μmol/ L). Thrombophilia profile of this patient showed within normal range of protein S (62%; normal range, 58.7–119.2%), protein C (115%; normal range, 70–130%) and antithrombin III (104%; normal range, 70–120%). Antiphospholipid antibodies including anticardiolipin IgM/IgG, anti-β2-glycoprotein 1 IgM/IgG, and lupus anticoagulant were within normal limits.

The genomic DNA extracted from patient was amplified with specific forward and reverse primers to detect FVL mutation (c.1601G>A), F2 gene variant (c.20210G>A), and MTFHR gene variants (c.677C>T and c.1298A>C) by polymerase chain reaction (PCR)-restriction fragment length polymorphism (Table 1). The amplified PCR products for FVL mutation (c.1601G>A), F2 variant (c.20210G>A), and MTFHR variants (c.677C>T and c.1298A>C) were digested with HinfI, MboII, and Mnl1 restriction enzymes, respectively (Table 2). Digested PCR products were separated by electrophoresis on 2% agarose gels containing ethidium bromide and visualized under ultraviolet light. TheF2 mutation (c.20210G>A) was evaluated by PCR-sequencing. In the F5 gene, heterozygous genotype c.1601G>A was detected (Fig. 1). The presence of the FVL mutation (c.1601G>A) was confirmed by direct PCR product sequencing (Fig. 2). The genotypes heterozygous wild type CT in position 677 and homozygous wild type AA in position 1298 of the MTHFR were determined. TheF2 mutation (c.20210G>A) was not detected. Her karyotype showed normal female.

On 4 months later, she was presented with pregnancy at her obstetrical visit. Estimated gestational age was 5 weeks as measured from the patient’s last menstrual period, which was confirmed by a first trimester crown-rump length. The couple was counseled about the autosomal dominant nature of FVL mutation. On the intake interview, the patient had no significant past medical history including thromboembolic disease. However, her father was diagnosed with a cerebral infarction and her grandmother died of myocardial infarction. The patient was advised folic acid supplementation and early antenatal registration with thromboprophylaxis in next pregnancy. In view of FVL mutation positive in pregnancy, the patient was started on low dose aspirin (100 mg) once daily and low-molecular-weight heparin (40 mg, Cnoxane; YOOYOUNG Pharm. Co. Ltd., Jincheon, Korea) subcutaneous injection once daily.

Discussion

In this report, we present the case of a Korean woman with a history of RPL that was complicated with the FVL mutation. In several studies, the potential clinical significance of hereditary thrombophilia factors, such as FVL mutation, F2 gene mutation, plasminogen activator inhibitor-1 gene polymorphism, protein S deficiency, protein C deficiency, and MTFHR gene polymorphism has been addressed [11,12]. A thrombophilia may result in impaired maternal fetal circulation by compromising the vascular system associated with significant fetal morbidity and mortality [13]. The FVL mutation has been significantly related to pregnancy complications associated with hypercoagulation, e.g., venous thromboembolism (VTE), hypertensive disorders of pregnancy, late pregnancy loss and stillbirth, placental abruption, and IUGR [14]. Recently, in meta-analysis, FVL mutation was associated with RPL (OR, 1.68; 95% CI, 1.16 to 2.44) [12]. VTE is the leading cause of morbidity and mortality in pregnancy and the postpartum period. VTE occurs in approximately 1 in 1,500 pregnancies, and up to one fourth of untreated deep vein thromboses may lead to pulmonary embolism [15]. Women with a personal history of VTE in a previous pregnancy have a higher prevalence of FVL mutation than those who have never had a VTE [15]. Patients who are heterozygous for this condition are at 3- to 8-fold increased risk for VTE; those who are homozygous are at 10- to 80-fold increased risk [16].

Current expert opinion recommends that management be based on the presence of current VTE, the presence of a past VTE, and risk factors for a VTE during pregnancy. High-risk thrombophilia, including FVL homozygosity, F2 mutation (c.20210G>A) homozygosity, heterozygosity for FVL mutation and F2 mutation (c.20210G>A), or antithrombin deficiency, recommend prophylactic anticoagulation therapy regardless of VTE history. Low-risk thrombophilia for women who are heterozygous for FVL mutation without previous VTE, such as the present case, the American College of Obstetricians and Gynecologists (2018) [17] recommends surveillance without anticoagulation therapy in pregnancy and postpartum period. However, even though low-risk thrombophilia without previous VTE, if the patient has additional risk factors, such as first-degree relative with a history of a thrombotic episode, or other thrombotic risk factors (e.g., obesity, prolonged immobility, cesarean delivery), postpartum prophylactic anticoagulation therapy is recommended.

Inherited thrombophilia has a different prevalence between various ethnic groups [6,7]. According to previous study of RPL in Korean women, FVL mutation was not found in any women and protein S deficiency was found 13.5% [11]. Another study for thrombophilia in Korean patients with VTE suggests that FVL mutation testing is unnecessary for Korean patients with VTE [10]. To our acknowledgment, this is the first case of FVL mutation in Korean. It is important to have a guideline for evaluation and management for Korean RPL women based on the evidence and our circumstances.

In conclusion, during pregnancy, patients with FVL mutation are at increased risk for VTE, intrauterine fetal death, IUGR, placental abruption, and preeclampsia. It is important to have a good knowledge of FVL mutation and its potential impact on pregnancy. Inherited thrombophilia has shown the ethnic difference signify the need for consideration in screening and interpretation. Appropriate counselling and clinical intervention should be considered during pregnancy to prevent adverse pregnancy outcomes.

Figures
Fig. 1.

Polymerase chain reaction (PCR)-restriction fragment length polymorphism for the factor V Leiden mutation was electrophoresed on a 2% agarose gel. The patient was shown to have a heterozygous genotype GA for this mutation. Lane 1, 50 bp DNA marker; Lane 2, PCR product of patient (genotype GA); Lane 3, positive control for genotype GG; Lane 4, positive control for genotype GA; Lane 5, positive control for genotype AA.


Fig. 2.

The chromatogram shows that nucleotide substitution from guanine to adenine at the position of 1601 base in factor V gene (c.1601G>A, p.Arg534Gln, NM_000130.4). (A–C) shows the sequences of positive control for genotype AA (A), GA (B), and GG (C), respectively. (D) shows the sequence that patient harbors c.1601G>A (p.Arg534Gln).


TABLES

Primer used to amplify variant polymorphisms of factor V Leiden (FVL) mutation, coagulation factor II, and MTFHR

PolymorphismPrimer sequences (5’ to 3’)Size (bp)
ForwardReverse
MTHFR (c.677C>T)TGAAGGAGAAGGTGTCTGCGGGAAGGACGGTGCGGTGAGAGTG198
MTHFR (c.1298A>C)ATGTGGGGGGAGGAGCTGACGTCTCCCAACTTACCCTTCTCC241
F2 (c.20210G>A)CCGCCTGAAGAAGTGGATACCTTCCTGAGCCCAGAGAGC197
FVL (c.1601G>A)TCCCAGTGCTTAACAAGACCATGTTATCACACTGGTGCTAA266

Restriction enzymes used to digest polymerase chain reaction products, and related product size

Restriction enzymePolymorphismSize (bp)
HinfIMTHFR
 Wild type allele 677C198
 Variant allele 677T175, 23

MboIIMTHFR
 Wild type allele 1298A204
 Variant allele 1298C241

MnlIFactor V Leiden
 Wild type allele 1601G164, 66, 36
 Variant allele 1601A200, 66

References
  1. Jaslow, CR, Carney, JL, and Kutteh, WH (2010). Diagnostic factors identified in 1020 women with two versus three or more recurrent pregnancy losses. Fertil Steril. 93, 1234-43.
    Pubmed CrossRef
  2. Rai, R, and Regan, L (2006). Recurrent miscarriage. Lancet. 368, 601-11.
    Pubmed CrossRef
  3. Brenner, B (1999). Inherited thrombophilia and pregnancy loss. Thromb Haemost. 82, 634-40.
    Pubmed CrossRef
  4. Younis, JS, Ohel, G, Brenner, B, and Ben-Ami, M (1997). Familial thrombophilia-- the scientific rationale for thrombophylaxis in recurrent pregnancy loss?. Hum Reprod. 12, 1389-90.
    Pubmed CrossRef
  5. Dahlbäck, B (1994). Inherited resistance to activated protein C, a major cause of venous thrombosis, is due to a mutation in the factor V gene. Haemostasis. 24, 139-51.
    Pubmed CrossRef
  6. Rees, DC, Cox, M, and Clegg, JB (1995). World distribution of factor V Leiden. Lancet. 346, 1133-4.
    Pubmed CrossRef
  7. De Stefano, V, Chiusolo, P, Paciaroni, K, and Leone, G (1998). Epidemiology of factor V Leiden: clinical implications. Semin Thromb Hemost. 24, 367-79.
    Pubmed CrossRef
  8. Kim, TW, Kim, WK, Lee, JH, Kim, SB, Kim, SW, and Suh, C (1998). Low prevalence of activated protein C resistance and coagulation factor V Arg506 to Gln mutation among Korean patients with deep vein thrombosis. J Korean Med Sci. 13, 587-90.
    Pubmed KoreaMed CrossRef
  9. Chang, JD, Hur, M, Lee, SS, Yoo, JH, and Lee, KM (2008). Genetic background of nontraumatic osteonecrosis of the femoral head in the Korean population. Clin Orthop Relat Res. 466, 1041-6.
    Pubmed KoreaMed CrossRef
  10. Kim, S, Song, I, Kim, HK, and Huh, S (2016). Thrombophilia in Korean patients with arterial or venous thromboembolisms. Ann Surg Treat Res. 90, 340-5.
    Pubmed KoreaMed CrossRef
  11. Lee, GS, Park, JC, Rhee, JH, and Kim, JI (2016). Etiologic characteristics and index pregnancy outcomes of recurrent pregnancy losses in Korean women. Obstet Gynecol Sci. 59, 379-87.
    Pubmed KoreaMed CrossRef
  12. Sergi, C, Al Jishi, T, and Walker, M (2015). Factor V Leiden mutation in women with early recurrent pregnancy loss: a meta-analysis and systematic review of the causal association. Arch Gynecol Obstet. 291, 671-9.
    Pubmed CrossRef
  13. Laurini, R, Laurin, J, and Marsál, K (1994). Placental histology and fetal blood flow in intrauterine growth retardation. Acta Obstet Gynecol Scand. 73, 529-34.
    Pubmed CrossRef
  14. Bloomenthal, D, von Dadelszen, P, Liston, R, Magee, L, and Tsang, P (2002). The effect of factor V Leiden carriage on maternal and fetal health. CMAJ. 167, 48-54.
    Pubmed KoreaMed
  15. Dizon-Townson, DS, Nelson, LM, Jang, H, Varner, MW, and Ward, K (1997). The incidence of the factor V Leiden mutation in an obstetric population and its relationship to deep vein thrombosis. Am J Obstet Gynecol. 176, 883-6.
    Pubmed CrossRef
  16. Gohil, R, Peck, G, and Sharma, P (2009). The genetics of venous thromboembolism. A meta-analysis involving approximately 120,000 cases and 180,000 controls. Thromb Haemost. 102, 360-70.
    Pubmed CrossRef
  17. American College of Obstetricians and Gynecologists’ Committee on Practice Bulletins–Obstetrics (2018). ACOG practice bulletin No. 196 summary: thromboembolism in pregnancy. Obstet Gynecol. 132, 243-8.
    Pubmed CrossRef


June 2019, 16 (1)
Full Text(PDF) Free

Social Network Service
Services

Cited By Articles
  • CrossRef (0)

Author ORCID Information